View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_high_27 (Length: 240)
Name: NF17502_high_27
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 32 - 237
Target Start/End: Original strand, 6083470 - 6083675
Alignment:
| Q |
32 |
gaacttgatattcgaaatgaagtccaattttcaagagtaatgctttcgcaaacagcgtcaaaactgttgcaacttgaatctgagattgattccaaaaacc |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6083470 |
gaacttgatattcgaaatgaagtccaattttcaagagtaatgctttcgcaaacagcgtcaaaactgttgcaacttgagtctgagattgattccaaaaacc |
6083569 |
T |
 |
| Q |
132 |
aagtagcatcggagcagcctagaagtcatgttgcattgcaagagttatctttggcatcaatgtcttacattggcagtgatgacaatgttagctgtggaga |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
6083570 |
aagtagcatcggagcagcctagaagtcatgttgcattgcaagagttatctttggcatcaatgtcttacattggcagtgatgacaatgttagctgcgggga |
6083669 |
T |
 |
| Q |
232 |
gtcctt |
237 |
Q |
| |
|
|||||| |
|
|
| T |
6083670 |
gtcctt |
6083675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 227
Target Start/End: Complemental strand, 39107438 - 39107390
Alignment:
| Q |
179 |
tctttggcatcaatgtcttacattggcagtgatgacaatgttagctgtg |
227 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| |||||||||| |
|
|
| T |
39107438 |
tctttggcatcaacgtctgatattggcagtgatgacaaggttagctgtg |
39107390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University