View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_high_31 (Length: 228)
Name: NF17502_high_31
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 64 - 216
Target Start/End: Original strand, 3642175 - 3642327
Alignment:
| Q |
64 |
gagggtgtgtgtggccataatcttaaaatacattaaactataaaatataaagagttccaaaatacaaacaatgtctcccagtcataactactaaactagc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3642175 |
gagggtgtgtgtggccataatcttaaaatacattaaactataaaatataaagagttccaaaatacaaacaatttctcccagtcataactactaaactagc |
3642274 |
T |
 |
| Q |
164 |
cactgtgtgtgaggggaatctaggattattcattaggaaatacagtattatct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3642275 |
cactgtgtgtgaggggaatctaggattattcattaggaaatacagtattatct |
3642327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Original strand, 3642131 - 3642159
Alignment:
| Q |
19 |
tttggagataatcttgtgtgaccataatt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3642131 |
tttggagataatcttgtgtgaccataatt |
3642159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University