View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_low_11 (Length: 324)
Name: NF17502_low_11
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 6083169 - 6082878
Alignment:
| Q |
16 |
atgcaactgccgcatacattcattgagagtacgatccaaatgcgcaactctttcttcgtaaattagttcctggtgtatagattcctcgagatgttccttc |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6083169 |
atgcaactgccgcatacattccttgagagtacgatccaaatgcgcaactctttcttcgtaaattagttcctggtgtatagattcctcgagatgttccttc |
6083070 |
T |
|
| Q |
116 |
attgacaacatttcagcttctgctttctcccatccttcaaatgaaccttttataagagactgatataactgttcttnnnnnnnnntatgcatattgattt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6083069 |
attgacaacatttcagcttctgctttctcccatccttcaaatgaaccttttataagagactgatataactgttcttaaaaaaaaatatgcatattgattt |
6082970 |
T |
|
| Q |
216 |
taattcatgcactcgtaactataagtgtaaagagttctcacactctcaatcaatcataaccgccggatcattaaacatttgacccttatcat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082969 |
taattcatgcactcgtaactataagtgtaaagagttctcacactctcaatcaatcataaccgccggatcattaaacatttgacccttatcat |
6082878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University