View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_low_14 (Length: 294)
Name: NF17502_low_14
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 5 - 154
Target Start/End: Original strand, 48254787 - 48254936
Alignment:
| Q |
5 |
aaacttagttttgttcaaggtttgtctaattttgnnnnnnnagttaagtagcaaagtgactagacattcatctct-aagatgaataagtggagtttggag |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| || |
|
|
| T |
48254787 |
aaacttagttttgttcaaggtttgtctaattttgtttttt-agttaagtagcaaagtgactagacattcatctcttaagatgaataagtggggtttgaag |
48254885 |
T |
 |
| Q |
104 |
tttgaactctgacctttaaaccttatcaagtgagttatgcttaggaggacg |
154 |
Q |
| |
|
||||||||| |||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
48254886 |
tttgaactccgacctttacatcttatcaactgagttatgcttaggaggacg |
48254936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 221 - 294
Target Start/End: Original strand, 48255003 - 48255076
Alignment:
| Q |
221 |
gtcaaataaataaaaacttaatggattattttataattaggaatcaaacttggtatcttatagtttaccacact |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48255003 |
gtcaaataaataaaaacttaatggattattttataattaggaatcaaacttggtatcttatagtttacaacact |
48255076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University