View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_low_30 (Length: 229)
Name: NF17502_low_30
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_low_30 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 120 - 229
Target Start/End: Original strand, 29940093 - 29940202
Alignment:
| Q |
120 |
ctcattcaaacaggccctgaatgtggcatgaagtcaaataatacactgtcttgaggtatgtattgaagcaacaacttatagttataacttataagaagat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29940093 |
ctcattcaaacaggccctgaatgtggcatgaagtcaaataatacactgtcttgagatatgtattgaagcaacaacttatagttataacttataagaagat |
29940192 |
T |
 |
| Q |
220 |
ggagtcatat |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
29940193 |
ggagtcatat |
29940202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 6 - 54
Target Start/End: Original strand, 29939979 - 29940027
Alignment:
| Q |
6 |
agttttggacagaaaataatccaattttaatgagtgttgtagataagag |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29939979 |
agttttggacagaaaataatccaattttaatgagtgttgtagataagag |
29940027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University