View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_low_33 (Length: 225)
Name: NF17502_low_33
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_low_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 225
Target Start/End: Original strand, 40379492 - 40379710
Alignment:
| Q |
7 |
gagaagaacgtttattaagacgcctctcttgttgcgatgtgatgattggtaagaagaaaataatagggtggtttgtgtttgcgttggcttgggtggttgg |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40379492 |
gagatgaacgtttattaagacgcctctcttgttacgatgtgatgattggtaagaagaaaataatagggtggtttgtgtttgcgttggcttggttggttgg |
40379591 |
T |
|
| Q |
107 |
tttccactgtatttgtaaccgtaatgaatggaagaaaggggaaccgtttactttgttttcgatcacattatttatttattgatgccacattccatatttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
40379592 |
tttccactgtatttgtaaccgtaatgaatggaagaaagggtaaccgtttaatttgttttcgatcacattatttatttattgatgccacattccttttttt |
40379691 |
T |
|
| Q |
207 |
ttagtatgaatgataagtc |
225 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40379692 |
ttagtatgaatgataagtc |
40379710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University