View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17502_low_8 (Length: 402)
Name: NF17502_low_8
Description: NF17502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17502_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 49943223 - 49943448
Alignment:
| Q |
19 |
gaaccctcttcagactcatcaggctgaaccctaagatccctaggttaattcacataagaaccctattgccctattatacaatgcaactttatatgctact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49943223 |
gaaccctcttcagactcatcaggctgaaccctaagacccctaggttaattcacataagaaccctattgccctattatacaatgcaactttatatgctact |
49943322 |
T |
|
| Q |
119 |
gttacctatatatctattctattacatctacatcatgcatcatccatttaccacttattactctcccnnnnnnngtaggcagagattttctcagatagtt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49943323 |
gttacctatatatctattctattacatctacatcatgcatcatccatttaccacttattactctccctttttttgtaggcagagattttctcagatagtt |
49943422 |
T |
|
| Q |
219 |
aagattttctcagcttttgtattgtt |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49943423 |
aagattttctcagcttttgtattgtt |
49943448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 273 - 392
Target Start/End: Original strand, 49943477 - 49943596
Alignment:
| Q |
273 |
gtctcagcgtttaatcacagttcttaacctcatccctctctcaatgaatacaatttcagtcgtctcattcacaaaagtcacacagtacctatgcatgaaa |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49943477 |
gtctcagcgtttaatcacagttcttaacctcatccctctctcatgcaatacaatttcagtcgtctcattcacaaaagtcacacagtacctatgcatgaaa |
49943576 |
T |
|
| Q |
373 |
cttcagcaaacaattctgtg |
392 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49943577 |
cttcagcaaacaattctgtg |
49943596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University