View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17503_high_2 (Length: 253)
Name: NF17503_high_2
Description: NF17503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17503_high_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 12720205 - 12720449
Alignment:
| Q |
9 |
agcatcagagagaacacttcctttttcaggaagcctaataccattagcttgaagaccattaactttattcttagcacaaaatgcatgaagattgtagtta |
108 |
Q |
| |
|
|||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12720205 |
agcagcagaaagaacacttggtttttcaggaagcctaataccattagcttgaagaccattaactttattcttagcacaaaatgcatgaagattgtagtta |
12720304 |
T |
 |
| Q |
109 |
cacaccgtgcaccgatacactttccccgaccttcgtttcttgcactcgttgcaaacgatcgtgttggaaagatcggtgtttgttgcggccccggtggtgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
12720305 |
cacaccgtgcaccgatacactttccccgaccttcgtttcttgcactcgttgcaaacaatcgtgttggaaagatcggtgtttgttgcagtcccggtggtgg |
12720404 |
T |
 |
| Q |
209 |
ttggtgaatgtgtaagtttgagagtgtgtggatgatttgggaatt |
253 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12720405 |
ttgatgaatgtgtaagtttgagagtgtgtggatgatttgggaatt |
12720449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University