View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17503_low_2 (Length: 394)
Name: NF17503_low_2
Description: NF17503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17503_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 7 - 382
Target Start/End: Original strand, 26449260 - 26449635
Alignment:
| Q |
7 |
acagagattgcaaatggatgtagtatgaaagcctctaagagagaggttatcatctgtaggaagcttgttatgcaacagtctccaaacaagcacggactta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26449260 |
acagagattgcaaatggatgtagtatgacagcctctaagagagaggttatcatctgtaggaagcttgttatgcaacagtctccaaacaagcaaggactta |
26449359 |
T |
|
| Q |
107 |
gaaggagggatagcaatgtgccaaatgactttggcccaactgatgttctgaggctgattggaagtcaggaagagatatgcgtctttaaaagctagatttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26449360 |
gaaggagggatagcaatgtgccaaatgactttggcccaactgatgttctgaggctgattggaagtcaggaagagatatgcgtctttaaaagctaaatttc |
26449459 |
T |
|
| Q |
207 |
catcatgagaggctttctatattagtttatcttctttagggaaaataggtatagtagtcaacaatagtttctgctgcaaagcaggatatgcaggcaaaga |
306 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |||||||| ||||||| |||| | |
|
|
| T |
26449460 |
catcatgagaggctttccatattagtttatcttctttagggacaataggtatagtagtcatcaatagtttttgctccaaagcagaatatgcaaccaaaaa |
26449559 |
T |
|
| Q |
307 |
agcttgaggaacattccaatttgaatctttgatgtaggtatccacattagattgcagaagatgatgtaaattctga |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26449560 |
agcttgaggaacattccaatttgaatctttgatgtaggtatccacattagattgcagaagatgatgtaaattctga |
26449635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University