View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_high_7 (Length: 242)
Name: NF17504_high_7
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 231
Target Start/End: Complemental strand, 25819655 - 25819443
Alignment:
| Q |
22 |
aagggtcgagattccgaataactattatgtcacttgagagaatcttctcccgcaagcaatagggttttctttgtcaagttcc---acaattagggttaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
25819655 |
aagggtcgagattccgaataactataatgtcacttgagagaatcttctcccgcaagcaatagggttttctttgtcaagttcctccacaattggggttaaa |
25819556 |
T |
|
| Q |
119 |
aacgtattcgagacctacccttttatcatgttcatagttattatcaagacactcaactagggtgaacaagtaaattgaatttcttctctcattcctcatg |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25819555 |
aacgtattcaagacctacccttttatcatgttcatagttattatcaagacactcaactagggtgaacaagtaaattgaatttcttctctcattcctcatg |
25819456 |
T |
|
| Q |
219 |
tttctcacaggtt |
231 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
25819455 |
tttctcaaaggtt |
25819443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University