View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_low_10 (Length: 227)
Name: NF17504_low_10
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 35614623 - 35614811
Alignment:
| Q |
15 |
atccctcttgacatatattttttattttcaaaactcaacatctcgatccttccttttaataaaaatgctctcgatccttcgtttagaaagcaagctcttt |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |||| ||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35614623 |
atccctcttgacatctattttttattttcaaaactcaatatctcgattcttctttttattaaaaatgctctccatccttcttttagaaagcaagctcttc |
35614722 |
T |
 |
| Q |
115 |
cac---ttacttatactttatatgtatttttaaaatcgtaatactatgttttgaactgttctcatgtcacttatagtaacaaacttaaa |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35614723 |
cacacattacttatactttatatgtatttttaaaatcgtaatactaggttttgaactgttctcatgtcacttatagtaacaaacttaaa |
35614811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 225
Target Start/End: Original strand, 35614848 - 35614876
Alignment:
| Q |
197 |
taaataaaataaaacaaagaatgagatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35614848 |
taaataaaataaaacaaagaatgagatgt |
35614876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University