View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_low_11 (Length: 215)
Name: NF17504_low_11
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 43281221 - 43281400
Alignment:
| Q |
17 |
cacagacttagtatttcgaagcccctgcaactatatgcaggaagcatgtgagaaagagcatggaattcttccacacacacatgatacacaattaattaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43281221 |
cacagacttagtatttcgaagcccctgcaactatatgcaggaagcatgtgagaaagagcatggaattcttccacacacacatgatacacaattaattaat |
43281320 |
T |
|
| Q |
117 |
attgattgtatattctactccgactcaaataatatactataaaaatggatcaacaaaatttgatatatttaggagaaaat |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43281321 |
attgattgtatattctactccgtctcaaataatatactataaaaatggatcaacaaaagttgatgtatttaggagaaaat |
43281400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University