View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_low_12 (Length: 214)
Name: NF17504_low_12
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 70 - 199
Target Start/End: Original strand, 40718630 - 40718759
Alignment:
| Q |
70 |
taataacaaagttaattcacattaggttttgttcattactagtataatgatctgtgtcaagcacgacatgcattaagtgaatcacgtgactgctgtttgc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718630 |
taataacaaagttaattcacattaggttttgttcattactagtataatgatccgtgtcaagcacgacatgcattaagtgaatcacgtgactgctgtttgc |
40718729 |
T |
|
| Q |
170 |
caaaatcagatgttgttccaccttctttgt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
40718730 |
caaaatcagatgttgtttcaccttctttgt |
40718759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 200
Target Start/End: Original strand, 17625943 - 17625973
Alignment:
| Q |
170 |
caaaatcagatgttgttccaccttctttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17625943 |
caaaatcagatgttgttccaccttctttgtg |
17625973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 200
Target Start/End: Complemental strand, 53320475 - 53320445
Alignment:
| Q |
170 |
caaaatcagatgttgttccaccttctttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53320475 |
caaaatcagatgttgttccaccttctttgtg |
53320445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 200
Target Start/End: Original strand, 128952 - 128980
Alignment:
| Q |
172 |
aaatcagatgttgttccaccttctttgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
128952 |
aaatcagatgttgttccaccttctttgtg |
128980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University