View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17504_low_13 (Length: 209)

Name: NF17504_low_13
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17504_low_13
NF17504_low_13
[»] chr1 (1 HSPs)
chr1 (1-209)||(29060291-29060500)


Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 29060500 - 29060291
Alignment:
1 tgccattaccttgaatttcaattttcataaatatttgaattgcc-tgaaacgtatttgtggctaagaatgaattgaaatgcaaataggaatacaatggat 99  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
29060500 tgccattaccttgaatttcaattttcataaatatttgaattgccctgaaacgtatttgtggctaagaatgaattgaaatgcaaatagggatacaatggat 29060401  T
100 tgaaattcacattttgaaaagtaacatggctagatatggcatgcattgttttgacttttgatgaaataattccaaacaaggaacacgaaatgaacacata 199  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29060400 tgaaattcacattttgaaaagtaacatggctatatatggcatgcattgttttgacttttgatgaaataattccaaacaaggaacacgaaatgaacacata 29060301  T
200 attaattgca 209  Q
    ||||||||||    
29060300 attaattgca 29060291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University