View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_low_13 (Length: 209)
Name: NF17504_low_13
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_low_13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 29060500 - 29060291
Alignment:
| Q |
1 |
tgccattaccttgaatttcaattttcataaatatttgaattgcc-tgaaacgtatttgtggctaagaatgaattgaaatgcaaataggaatacaatggat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29060500 |
tgccattaccttgaatttcaattttcataaatatttgaattgccctgaaacgtatttgtggctaagaatgaattgaaatgcaaatagggatacaatggat |
29060401 |
T |
|
| Q |
100 |
tgaaattcacattttgaaaagtaacatggctagatatggcatgcattgttttgacttttgatgaaataattccaaacaaggaacacgaaatgaacacata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29060400 |
tgaaattcacattttgaaaagtaacatggctatatatggcatgcattgttttgacttttgatgaaataattccaaacaaggaacacgaaatgaacacata |
29060301 |
T |
|
| Q |
200 |
attaattgca |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
29060300 |
attaattgca |
29060291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University