View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17504_low_9 (Length: 238)
Name: NF17504_low_9
Description: NF17504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17504_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 32 - 228
Target Start/End: Complemental strand, 22294746 - 22294550
Alignment:
| Q |
32 |
tcatattgatcagtgatactactgaggttggactaacactttgatggattgggagtgtcagtcagtgatgaaatggagtggaccactgtgtgatataatt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22294746 |
tcatattgatcagtgatactactgaggttggactaacactttgatggattgggagtgtcagtcagtgatgaaatggagtggaccactgtgtgatataatt |
22294647 |
T |
 |
| Q |
132 |
atattatgttatgtgttgctgtttttggggtttcacccaaagttctgtcttttcccttttcagaccaactacaaacagatcattttcaccacctttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22294646 |
atattatgttatgtgttgctgtttttggggtttcacccaaagttctgtcttttcccttttcagaccaactacaaacagattattttcaccacctttg |
22294550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University