View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_high_11 (Length: 283)
Name: NF17505_high_11
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 30472427 - 30472164
Alignment:
| Q |
1 |
ataggaaatgttaacttgtattttaaggcagaagttaattaataaaatatagagtacctgttaacttgacc-taacttattttaggaggcattt-gaagc |
98 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
30472427 |
ataggaaatgttaacttgtgctttaaggcagaagttaattaataaaata--gagtacctgttaacttgaccctaacttattttaggaggcattccgaagc |
30472330 |
T |
 |
| Q |
99 |
tattttctttgtgtagtcgtggtgtgttaaccgttaacactatgtacctctttaacgtaactcctggaacattttatgtctttgtctactgccccacaaa |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30472329 |
tattttctttgtgtagtcgtggtgtgttaaccgttaacattatgtacctctttaac-----tcctggaacattttatgtctttgtctacttccccacaaa |
30472235 |
T |
 |
| Q |
199 |
ttaacacgagcctatgctatggttacggtggtgactgatggtggcactctattgttatatatcactcttgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472234 |
ttaacacgagcctatgctatggttacggtggtgactgatggtggcactctattgttatatatcactcttgt |
30472164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University