View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_high_14 (Length: 265)
Name: NF17505_high_14
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 36684688 - 36684920
Alignment:
| Q |
20 |
ttttatacaacccaaatcctttaccacaatttcattgggaagctagatggctttggactgttcgattaagagagaaattttttaagattatgagagatcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36684688 |
ttttatacaacccaaatcctttaccacaatttcattgggaagctagatggctttggactgttcgattaagagagaaaatttttaagattatgagagatcc |
36684787 |
T |
|
| Q |
120 |
tctataatctaacggggtcttctgcatcgtaaagccaaatgtagagaatttaatttgtgttttatagacttttttaaatcttcttttaatatcgatctaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36684788 |
tctataatctaacggggtcttctgcatcgtaaagccaaatgtagagaatttaatttgtgttttatagacttttttaaatcttcttttaatatcgatctaa |
36684887 |
T |
|
| Q |
220 |
accatcacggctcattaagttagtccctttgct |
252 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
36684888 |
actatcacggctcattaagttagtccctttgct |
36684920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University