View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_high_17 (Length: 264)
Name: NF17505_high_17
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 260
Target Start/End: Original strand, 25369406 - 25369650
Alignment:
| Q |
16 |
atctagagacaagaaagaatgcgataagtttaggaaacatactaaatgctggcgccttcatcaaaattctatctgtttcagttatttattttgttgagtt |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25369406 |
atctagagacaagaaaggatgcgataagtttaggaaacagactaaatgctggcgccttcatcaaaattctatctgtttcagttatttattttgttgagtt |
25369505 |
T |
 |
| Q |
116 |
ctttacctgagttccaatatctctacctgtgtatgttttacagtcttgtaggttccttaaacaagattccaatctctattgctggcattatagtgttcaa |
215 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25369506 |
ctttagctgagttccaatatctctacttgtgtatgttttacagtcttgtaggttccttaaacaagattccaatctctattgctggcattatagtgttcaa |
25369605 |
T |
 |
| Q |
216 |
tgttcctctgagtatatcaaatttattcagcattttatttggtaa |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25369606 |
tgttcctctgagtatatcaaatttattcagcattttatttggtaa |
25369650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University