View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_high_25 (Length: 227)
Name: NF17505_high_25
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_high_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 64 - 227
Target Start/End: Complemental strand, 10358486 - 10358323
Alignment:
| Q |
64 |
gatactgaatgaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
163 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358486 |
gatactgaataaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
10358387 |
T |
 |
| Q |
164 |
ttttttgaatgttgtgatttgatattgttgctgcgtcctgtttcgtgtgatttttgaaattaaa |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
10358386 |
ttttttgaatcttgtgatttgatattgttgttgcgtcctgtttcgtatgatttttgaaattaaa |
10358323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University