View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_low_10 (Length: 305)
Name: NF17505_low_10
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_low_10 |
 | |
|
| [»] scaffold0149 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0149 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: scaffold0149
Description:
Target: scaffold0149; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 31064 - 30872
Alignment:
| Q |
11 |
gtaacataggtgctccccgacaaccatcattgcattgcaagcttagcaagaaagcatctcgaaaatatcaaggtcgtctgttgattttcaaaagtattac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
31064 |
gtaacataggtgctccccgacaaccatcattgcattgcaagcttagcaagaaagcatctcaaaaatatcaaggttgtctgttgattgtcaaaagtattac |
30965 |
T |
|
| Q |
111 |
aaactaattaagtcataaagacgataagggtttcaaagaaacagtttcaaaccgaacgtcggcccaacaacgatttactaatgaaatcccaac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30964 |
aaactaattaagtcataaagacgataagggtttcaaagaaacagtttcaaaccgaacctcggcccaacaaagatttactaatgaaatcccaac |
30872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University