View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_low_17 (Length: 264)
Name: NF17505_low_17
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 13146007 - 13145884
Alignment:
| Q |
18 |
catattgctctccaatattatgctatatacacttttgaagaatacttccgtttctctacacaacttagtaattcatctgtatatgctatattattaacaa |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13146007 |
catattgctctacaatattatgctatatacacttttgaagaatatttccgtttctctatacaacttagtaattcatctgtatatgctatattcttaacaa |
13145908 |
T |
|
| Q |
118 |
acaacacatacaagccttcaacat |
141 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13145907 |
acaacacatacaagccttcaacat |
13145884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 147 - 202
Target Start/End: Complemental strand, 13145836 - 13145781
Alignment:
| Q |
147 |
atccaaagaatgattcactgacttcatatttatcatttccctttatgcatccatat |
202 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
13145836 |
atccaaaaaatgattcactgagttcatgtttatcatttccctttatgcatccatat |
13145781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University