View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_low_19 (Length: 260)
Name: NF17505_low_19
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 25369970 - 25369737
Alignment:
| Q |
17 |
acctttatagttgataattcccttgcaggtgtaccctatactacttattccagattttaggatcatccgttaaaataagagtttgaatttgcattggatc |
116 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25369970 |
acctttatagctgatacttcccttgcaggtgtaccctatactacttattccagattttaggatcatccgttaaaataagagtttgaatttgcattg-atc |
25369872 |
T |
 |
| Q |
117 |
aaacaaaaacctatatagttatcattcatgtattaactcttacatttcattggttattactatgaatatgattgcttctggtttaagacatcttggctct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
25369871 |
aaacaaaaacctatatagttatcattcatgtattaactcttacatttcattggttattactatgaatacgattgcttctggtttaagacatctttgctct |
25369772 |
T |
 |
| Q |
217 |
tgcaaataatataccagcaaagagacctgagaata |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
25369771 |
tgcaaataatataccagcaaagagacctgaaaata |
25369737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University