View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_low_20 (Length: 256)
Name: NF17505_low_20
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_low_20 |
 |  |
|
| [»] scaffold0149 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0149 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: scaffold0149
Description:
Target: scaffold0149; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 15 - 256
Target Start/End: Complemental strand, 31282 - 31041
Alignment:
| Q |
15 |
caaaggcaaacatagtatggcgggatgtgaaaacctttaaatttttatagctcatctttatcaacgattgaattcgttggatggtaaaaaatcaagaatc |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31282 |
caaagacaaacatagtatggcgggatgtgaaaacctttaaatttttatagctcatctttatcaacgattgaattcgttggatggtaaaaaatcaagaatc |
31183 |
T |
 |
| Q |
115 |
aatactccagataagacatcaagaatgtagcctcacacgacaaatctctcaaaaaagggtggtttcagagtaccagcaataaatggtgcatctgaaaccc |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31182 |
aatactccagataagacatcaagagtgtagcctcacacggcaaatctctaaaaaaagggtggtttcagagtaccagcaataaatggtgcatctgaaaccc |
31083 |
T |
 |
| Q |
215 |
actcaaaactcttcatttgtaacataggtgctccccgacaac |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31082 |
actcaaaactcttcatttgtaacataggtgctccccgacaac |
31041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University