View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17505_low_29 (Length: 203)
Name: NF17505_low_29
Description: NF17505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17505_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 44006299 - 44006472
Alignment:
| Q |
16 |
taacatgatgattatgtcattacggaaaaaattatttaaccaataaccatgtttatagtagccaattatcaatcaagaaaaagtaatcaattgatgtgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006299 |
taacatgatgattatgtcattacggaaaaaattatttaaccaataaccatgtttatagtagccaattatcaatcaagaaaaagtaatcaattgatgtgtg |
44006398 |
T |
|
| Q |
116 |
ataactcttcattagt--aaaagtttttcggcatcttttagtgtcatctgcgtatttatttgttattagtatta |
187 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006399 |
ataactcttcattagtaaaaaagtttttcggcatcttttagtgtcatctgcgtatttatttgttattagtatta |
44006472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University