View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17507_high_11 (Length: 254)
Name: NF17507_high_11
Description: NF17507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17507_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 59 - 139
Target Start/End: Original strand, 5421739 - 5421819
Alignment:
| Q |
59 |
actacaagatttctatattgcagctcaaagcgtagacatggagtattggcatgaaaatcttccttgcaaaaaggagcatgc |
139 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5421739 |
actataagatttctatattgcaactcaaagcgtagacatggagtattggcatgaaaatcttccttgcaaaaaggagcatgc |
5421819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 237
Target Start/End: Original strand, 5421816 - 5421871
Alignment:
| Q |
181 |
atgcccttattacttcttttactactcaaagcaacattagcattcatggatagttaa |
237 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5421816 |
atgcccttattgcttcttt-actactcaaagcaacattggcattcatggatagttaa |
5421871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University