View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17507_low_12 (Length: 235)
Name: NF17507_low_12
Description: NF17507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17507_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 25819897 - 25820069
Alignment:
| Q |
1 |
taattcaaagattaattttaagagtatgaatgtttgaatgattttgaattcaatcttaaaactgtggcaacattattgtaaactcttgaagttgaacatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25819897 |
taattcaaagattaattttaagagtatgaatgtttgaatgattttgaattcaatcttaaaactgtggcaacattattgtaaactcttgaagttgaacgtt |
25819996 |
T |
|
| Q |
101 |
accgtctatatggtcatatttgactcgagaagttagttgcaacagttgtgtacgaaaatacctgaattcacat |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25819997 |
accgtctatatggtcatatttgactcgagaaattagttgcaacagttgtgtacgaaaatacctgatttcacat |
25820069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University