View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17507_low_6 (Length: 408)
Name: NF17507_low_6
Description: NF17507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17507_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 38931259 - 38931593
Alignment:
| Q |
1 |
tttaaatgatatagttcaatgta--acacgtgacttctgcaatacagaattgcagaatgatgcacttatttagttaccttgtagaggtaaacccattggg |
98 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38931259 |
tttaaatgatatagttcagtgtctgacacgtgacttctgcaattcataattgcagaatgatgcacttatttaattaccttgtagaggtaaacccattggg |
38931358 |
T |
 |
| Q |
99 |
cactaagatgaagcaatttgagaactgggagagtcaaactattgacattcgttatacgacctgctcttgggttaaacacatcggcacgtgaaggatcagc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931359 |
cactaagatgaagcaatttgagaactgggagagtcaaactattgacattcgttatacgacctgctcttgggttaaacacatcggcacgtgaaggatcagc |
38931458 |
T |
 |
| Q |
199 |
tatgttctcatgaagcttcaatgtgcaaacggtttcatcgaagaagttgtgttgttcttcatgttctctggttcttgttctctcaccatggcttctttct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931459 |
tatgttctcatgaagcttcaatgtgcaaacagtttcatcgaagaagttgtgttgtccttcatgttctctggttcttgttctctcaccatggcttctttct |
38931558 |
T |
 |
| Q |
299 |
ttttcaccatggtgacaatgctctttagtttttgt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931559 |
ttttcaccatggtgacaatgctctttagtttttgt |
38931593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University