View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17508_high_2 (Length: 415)
Name: NF17508_high_2
Description: NF17508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17508_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 102 - 399
Target Start/End: Complemental strand, 46162870 - 46162574
Alignment:
| Q |
102 |
aaaatttcaattctttctcattcacatcgttgctatctcttcctctttcgctggccactgtgctgccggccaccgccatcgaaaaataactgatggagac |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||||| |||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
46162870 |
aaaaattcaattctttctcattcacatcgttgttatctcttcctctgtcgctggctactgtgccgccggccaccgccaccgaaaa-taaatgatggagac |
46162772 |
T |
 |
| Q |
202 |
gggtccaagttccgcaagcttctaaataacaggttgagcgcccaatcacggcgtagacaaagaagaggatgcgacggaggtggggcagagtgaaactgtt |
301 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46162771 |
gggtccaagttctacaagcttctcaataacgggttgagcgcccaatcacgacgtagacaaagaagaggatgcgacggaggtggggcagagtgaaactgtt |
46162672 |
T |
 |
| Q |
302 |
cctcttcctcatccgcctctcaaatctacccaaattcaaagaaacatctctcaccaccgttacttctcatcgacgtcgaagccggatctaaacagaaa |
399 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46162671 |
cctcttccttatcctcctctcaaatctacccaaattcaaagaaacatctctcaccaccgttacttctcatcgacgtcgaagccggatctaaacagaaa |
46162574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 233 - 302
Target Start/End: Complemental strand, 28321676 - 28321606
Alignment:
| Q |
233 |
ggttgagcgcccaatcacggcgtagacaaagaagaggatgcgacggaggtggg-gcagagtgaaactgttc |
302 |
Q |
| |
|
|||||||||||| | ||| || |||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
28321676 |
ggttgagcgcccgagcacaacggagacgaagaagagggcgcgacggaggtgggtgcagagtgaaactgttc |
28321606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 55 - 85
Target Start/End: Original strand, 29932739 - 29932769
Alignment:
| Q |
55 |
gtacttaggggccaaaattgcaagtttttga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29932739 |
gtacttaggggccaaaattgcaagtttttga |
29932769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 55 - 85
Target Start/End: Original strand, 29981893 - 29981923
Alignment:
| Q |
55 |
gtacttaggggccaaaattgcaagtttttga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29981893 |
gtacttaggggccaaaattgcaagtttttga |
29981923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 56 - 85
Target Start/End: Complemental strand, 7314939 - 7314910
Alignment:
| Q |
56 |
tacttaggggccaaaattgcaagtttttga |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7314939 |
tacttaggggccaaaattgcaagtttttga |
7314910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University