View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17508_high_9 (Length: 236)
Name: NF17508_high_9
Description: NF17508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17508_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 6515938 - 6515718
Alignment:
| Q |
16 |
atttcggccgcttccaaagcagcttttgctttctgtgtctctacttcagctaaagctaatgcagcctcttcagcaagccttgctttttcaacattttgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515938 |
atttcggccgcttccaaagcagcttttgctttctgtgtttctacttcagctaaagctaatgcagcctcttcagcaagccttgctttttcaacattttgct |
6515839 |
T |
 |
| Q |
116 |
cttcttcttctctaaacttttcaatttcacttgcctaaatgaaaaataatcgtcttttagactannnnnnncattaatttattaaatctatttgtttaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6515838 |
cttcttcttctctaaacttttcaatttcacttgcctaaatgaaaaataatcgtcttttagactatttttttcattaatttattaaatctatttgtttaaa |
6515739 |
T |
 |
| Q |
216 |
gttaaattcaagcataatttt |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6515738 |
gttaaattcaagcataatttt |
6515718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University