View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17508_low_8 (Length: 273)
Name: NF17508_low_8
Description: NF17508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17508_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 57 - 261
Target Start/End: Complemental strand, 34867199 - 34866995
Alignment:
| Q |
57 |
acatgttttaaaatatgcaaaaccctgtcaaggttgaactgcttctaaaggcagaattattttctattcgtcatgctgttttcgataaagattttaggca |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867199 |
acatgttttaaaatatgcaaaaccctgtcaaggttgaactgcttctaaaggcagaattattttctattcgtcatgctgttttcgataaagattttaggca |
34867100 |
T |
 |
| Q |
157 |
acgcctaccctacttcactgatcttgttgaagggataaatttccttaatgattggttttcttggaacttgtatatgcagaaagttagatatatagtggaa |
256 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34867099 |
acgcctaccctacttcactgatcctgttgaagggataaatttccttaatgattggttttcttggaacttgtatatgcagaaagttagatatatattggaa |
34867000 |
T |
 |
| Q |
257 |
atttt |
261 |
Q |
| |
|
||||| |
|
|
| T |
34866999 |
atttt |
34866995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 34867616 - 34867558
Alignment:
| Q |
1 |
ttcactcagataacaccgaaatgatccttaaaatctcatgccatatattgattgtgaca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34867616 |
ttcactcagataacaccgaaatgatccttaaaatctcatgccacatattgattgtgaca |
34867558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 172
Target Start/End: Original strand, 51856675 - 51856765
Alignment:
| Q |
82 |
tgtcaaggttgaactgcttctaaaggcagaattattttctattcgtcatgctgttttcgataaagattttaggcaacgcctaccctacttc |
172 |
Q |
| |
|
||||| ||||||| ||| || ||||||| || |||||||| | |||||| |||||| || ||| |||||||||||||||||| |||||| |
|
|
| T |
51856675 |
tgtcatggttgaagtgcatccaaaggcaccatgattttctacttgtcatgttgttttttattaagtttttaggcaacgcctaccatacttc |
51856765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University