View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17509_low_10 (Length: 214)
Name: NF17509_low_10
Description: NF17509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17509_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 49449379 - 49449195
Alignment:
| Q |
13 |
catcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttggaatgatcatttctttattttgaaggtagaggttgatgcttac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49449379 |
catcaacaacaagaacacggtggttgattttgaaccaagaatttacatagttagttggaatgatcatttctttattttgaaggtagaggttgatgcttac |
49449280 |
T |
|
| Q |
113 |
tatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtgttgaagtttgatgattcatgtgtgatgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49449279 |
tatatcattgattcattgggtgagagactttttgaagggtgtcaaagggcatttgtgttgaagtttgatgattcatgtgtgatgt |
49449195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University