View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17509_low_7 (Length: 314)
Name: NF17509_low_7
Description: NF17509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17509_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 288
Target Start/End: Original strand, 37982676 - 37982940
Alignment:
| Q |
20 |
cagcagtccttcaatttgctgataatcaagtgtcaaggccctgctatatgccagcattggacactcttatcacattgggnnnnnnntgctgatcactctt |
119 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
37982676 |
cagcggtcctgcaatttgctgataatcaagtgtcaaggccctactatatgccagcattgggcactcttatcacattgggaaaaaaatgttgatcactctt |
37982775 |
T |
 |
| Q |
120 |
catcggttctggacaaagttcacaattgagaggacataaaatatatttatcatgtaatctaagacgagtcggacaaacaactcctccatatactcgaaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
37982776 |
catcggttctggacaaagttcacaattgagaggacataaaatatatttatcatgtaatctacgacgagtcagacaaacaa---ctccatatactcgaaac |
37982872 |
T |
 |
| Q |
220 |
tagagattacaaactttaggagggactaacattcacaaaatattccaatctccctccagatgaaacttc |
288 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
37982873 |
tagaga-tacaaactttaggagggactaacattcacaaaatatttcaatctcccttcaaatgaaacttc |
37982940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University