View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_high_19 (Length: 226)
Name: NF1750_high_19
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 32993558 - 32993703
Alignment:
| Q |
1 |
ctcaactgccccaaaagtctcaatcatatatttaaatgtgttatattatattgcatgcaacttgtttgtttcatgggatttaggattgaaaaattgcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
32993558 |
ctcaactgccccaaaagtctcaatcatatatttaaatgtgttatattatattgcatgcaacttgtt-gtttcatgggatttaggattgaagaattgcact |
32993656 |
T |
|
| Q |
101 |
tgcatcagctaagatatctttaactagtgtccacacattctcccgcc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32993657 |
tgcatcagctaagatatctttaactagtgtccacacattctcccgcc |
32993703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 165 - 196
Target Start/End: Original strand, 32993728 - 32993759
Alignment:
| Q |
165 |
agtatatgggactagtgcttttgcattaatgc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32993728 |
agtatatgggactagtgcttttgcattaatgc |
32993759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University