View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_high_2 (Length: 558)
Name: NF1750_high_2
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_high_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 73 - 558
Target Start/End: Original strand, 28953363 - 28953848
Alignment:
| Q |
73 |
tcgaagatgaagaaccctacggcgaagtcnnnnnnnttatcggaagcaaagccttggaagattccaccggcatggaatatctcatcgaatgggaagatgg |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28953363 |
tcgaagatgaagaaccctacggcgaagtcaaaaaaattatcggaagcaaagccttggaagattccaccggcatggaatatctcatcgaatgggaagatgg |
28953462 |
T |
|
| Q |
173 |
ccatgaaccttcctgggtccccgccgacttcatagcaaaagacgtcgtcgctgaatacgaaactccctggtggaccgccgcaagaaaatccgacgaaaat |
272 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28953463 |
ccatcaaccttcctgggtccccgccgacttcatagcaaaagacgtcgtcgctgaatacgaaactccctggtggaccgccgctagaaaatccgacgaaaat |
28953562 |
T |
|
| Q |
273 |
gccctcaaaacaatccttgaagccgacgattaccgtgacgaaaaggcagtagactctgatggtagaacagctcttctctttgtagctggccgcggctcag |
372 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
28953563 |
gccctcaaaacaatccttgaagccgacgattaccgcgacgtaaatgcagtagactctgatggtagaacagcacttctatttgtagctggcctcggctcag |
28953662 |
T |
|
| Q |
373 |
agccatgcgttaggctcttagccgaagctggcgccaatttagaccaccgcgataatagcggtggtctatccgcgctgcacatggcagccggatatgtaag |
472 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28953663 |
agccatgcgttaggctcttagccgaagctggcgccaatttagaccaccgcgataatagcggtggtctatccgcgctgcacatggcagccggatatgtaag |
28953762 |
T |
|
| Q |
473 |
acctggagtagcaaaactactcttggagcttggcgctgatccggaaatcagcgacgatcgtggaagaacagcgttggatttagcga |
558 |
Q |
| |
|
||||||||||||||||||||||||||| || || |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28953763 |
acctggagtagcaaaactactcttggaactcggtgctgatccggaaattagcgacgatcgtggaagaacagcgttggatttagcga |
28953848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University