View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_high_9 (Length: 328)
Name: NF1750_high_9
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 37 - 312
Target Start/End: Complemental strand, 40898010 - 40897736
Alignment:
| Q |
37 |
ggtgtatgttttggctgtacgaagcaatggatttgatgcgagttataagaaaatgagattggctctattgagtgtaatgttggtggtgatacttgttgct |
136 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||||| |||||| ||||||||| ||||||||||||||| ||||||||| || |||||||||||||| |
|
|
| T |
40898010 |
ggtgaatgttttggctgtaccaagaaatggatttgatgtgagttacaagaaaatgggattggctctattgaatgtaatgttagtaatgatacttgttgct |
40897911 |
T |
 |
| Q |
137 |
gtcttaggttttctatttatagatggtagagccataaggagagaaatgcatctgtgtgcctcactcatcaaacaaaaagaggccactcaccaagttgaga |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
40897910 |
gtcttaggttttctatttatagatggtagagccataaggagagaaatgcatttgtgtgcctcacttatcaaacaaaaagaggccactcaccaagctgaga |
40897811 |
T |
 |
| Q |
237 |
ggaaaaaatatgaacaagagcctcgtcgttgctagcgccagccacgacgtttgcacttctcttgcaggcattactg |
312 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||| || ||| |||||||||| ||||||||||||| |
|
|
| T |
40897810 |
-gaaaaaatatgaacaagagcctcgccgttgctagcgctagccatgatgttcgcacttctctcgcaggcattactg |
40897736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University