View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_low_17 (Length: 300)
Name: NF1750_low_17
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 14 - 283
Target Start/End: Original strand, 51845193 - 51845458
Alignment:
| Q |
14 |
gaaacaaacactatcctagttgagcatgggaatgaaaatgtttattgcttttctattccccctcctaaatattcaacgggtggttaaaatagtaaactaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51845193 |
gaaacaaacactatcctagttgagcatgggaatgaaaacgtttattgcttttctattccccctcctaaatattcaacgggtggttaaaatagtaaactaa |
51845292 |
T |
|
| Q |
114 |
gatatgatgttaatgatcacataaaagcttagtcacaaagaacaaaggacatatagatttctagttttttatttcaaatgtcatttcattgttccttgtt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51845293 |
gatatgatgttaatgatcacataaaagcttagtc---aagaacaaaggacatatagatttctag-tttttatttcaaatggcatttcattgttccttgtt |
51845388 |
T |
|
| Q |
214 |
tagtccctggtggaaatttagtgtattataaatatttagtgttgtagccaggatatgaaattgacaagca |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51845389 |
tagtccctggtggaaatttagtgtattataaatatttagtattgtagccaggatatgaaattgacaagca |
51845458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University