View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_low_20 (Length: 237)
Name: NF1750_low_20
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 4169629 - 4169406
Alignment:
| Q |
16 |
caaatatgtttgttattggtactaaagatgcattgaaacaattatgatgacttttttagtatcagaattttcatgaacatgttcctagaaaaaattatgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4169629 |
caaatatgtttgttattggtactaaagatgcattgaaacaattatgatgacttttttagtatcagaattttcatgaacatgttcctacaaaaaattatgc |
4169530 |
T |
|
| Q |
116 |
aaactactgctac--tatcattgtggctacatagcaaattaagaaaaaattataccaccattatttcatgtgatttgaagagttgaaactatcatagtat |
213 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4169529 |
aaactactgctactatatcattggggctgcatagcaaaataagaaaaaattataccaccattatttcatgtgatatgaagagttgaaactatcatggtat |
4169430 |
T |
|
| Q |
214 |
cccaaacgatttcactgggtttac |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4169429 |
cccaaacgatttcactgggtttac |
4169406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University