View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1750_low_21 (Length: 230)
Name: NF1750_low_21
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1750_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 3 - 142
Target Start/End: Complemental strand, 6996914 - 6996775
Alignment:
| Q |
3 |
aaatagcatcgttaaagagctaatttgactatattgccggacaattttcaaaatttaatataattttattgaagtctctagtactgaacataatataata |
102 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6996914 |
aaatagcatctttaaagagttaatttgactatatcgccggacaattttcaaaatttaatataattttattgaagtctctagtaatgaacataatataata |
6996815 |
T |
 |
| Q |
103 |
attaatatgttacaatttcaagacgaaatcgctaattcat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6996814 |
attaatatgttacaatttcaagacgaaatcgctaattcat |
6996775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 40898223 - 40898164
Alignment:
| Q |
101 |
taattaatatgttacaatttcaagacgaaatcgctaattcataatgttgaggactaattt |
160 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||||||||||||||| || ||||||||| |
|
|
| T |
40898223 |
taattgatatgttacaacttcaagacaaaatcgctaattcataatgtcgatgactaattt |
40898164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University