View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1750_low_24 (Length: 223)

Name: NF1750_low_24
Description: NF1750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1750_low_24
NF1750_low_24
[»] chr2 (1 HSPs)
chr2 (14-208)||(32993955-32994151)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 14 - 208
Target Start/End: Original strand, 32993955 - 32994151
Alignment:
14 aatatgataaagaaaaatatttcatgaacactcgatatctattttactctttgaaaaataaaagaatagaaaatatgatatgatatgttagtgatgtggt 113  Q
    |||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
32993955 aatatgataaagaaaaatatttcatggacactcaatatctattttactctttgaaagataaaagaatagaaaatatgatatgatatgttagtgatgtggt 32994054  T
114 gagaaaagagatatagtgaaagcaaatcatataaataatagta--nnnnnnnnncaagaagaaataaataatagtatgttttataagcgtatttttt 208  Q
    |||||||||||||||||||||||||||||||||||||||||||              ||||||||||||||||||||||||||||||||||||||||    
32994055 gagaaaagagatatagtgaaagcaaatcatataaataatagtattttttttttttttgaagaaataaataatagtatgttttataagcgtatttttt 32994151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University