View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751-Insertion-15 (Length: 439)
Name: NF1751-Insertion-15
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751-Insertion-15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 83 - 426
Target Start/End: Complemental strand, 39426961 - 39426618
Alignment:
| Q |
83 |
aataaattattatgatgatattatggattcaaagtaacttggaaccaaggagaatgtagcacaacattggacatcataaaatagttcaaaatgacaaatt |
182 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426961 |
aataagttattatgatgatattatggattcaaagtaacttggaaccaaggagaatgtagcacaacattggacatcataaaatagttcaaaatgacaaatt |
39426862 |
T |
|
| Q |
183 |
ttggaaccaaggagaatgtaatttggaaatttaacatggcactcgtgaatttctacacaggagcaaaacaatttcaatgcatgcaacataacccatttat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426861 |
ttggaaccaaggagaatgtaatttggaaatttaacatggcactcatgaatttctacacaagagcaaaacaatttcaatgcatgcaacataacccatttat |
39426762 |
T |
|
| Q |
283 |
ttttactatgtaatttcttaaaacataatcactttatggaaataggagaacataatttcacccaaaacccacctaaaattgtgaattgagaagagtaatg |
382 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39426761 |
ttttattatgtaatttcttaaaacataatcactttatggaaataggagaacataatttcacccaaaacccacctaaaattgtgaatggagaagagtaatg |
39426662 |
T |
|
| Q |
383 |
aagatttccccttcttttacctctcttcaagttcttctctcttc |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39426661 |
aagatttccccttcttttacctctcttcaagttcttctctcttc |
39426618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University