View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751-Insertion-23 (Length: 256)
Name: NF1751-Insertion-23
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751-Insertion-23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 31141055 - 31140816
Alignment:
| Q |
8 |
gtatctatgtcccacaggatatccttcttacacatatgagta-aggagatggaatcgatggatgcagatcgagaaagaaacaaatttgcggtaggttgag |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31141055 |
gtatctatgtcccaaaggatatccttcttacacatatgagtagaagagatggaattgatggatgcagattgagaaagaaacaaatttgcggtaggttgag |
31140956 |
T |
|
| Q |
107 |
ttgaaacaaaatttgtatttcatgatgatgaatcgaagtatagaaaagtcatagtaaaacttctatacttaagtactacccggacatatacctctttctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31140955 |
ttgaaacaaaatttgtatttcatgatgatgaatcaaagtatagaaacgtcgtagtaaaacttctatacttaagtactacccggacatatacctctttctt |
31140856 |
T |
|
| Q |
207 |
tgcccgatgattgagtcaacatgtctccaaaagtcaacaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31140855 |
tgcccgatgattgagtcaacatgtctccaaaagtcaacaa |
31140816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University