View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751-Insertion-26 (Length: 153)
Name: NF1751-Insertion-26
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751-Insertion-26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 4e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 7 - 153
Target Start/End: Complemental strand, 34391865 - 34391719
Alignment:
| Q |
7 |
agtcggtttgattgaggtgagttgataaagtgataaggtgtgtgtcaagagatattggttcaacaaatttggtggcctggaatatacttgtgattctttg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34391865 |
agtcggtttgattgaggtgagttgataaagtgataaggtgtgtgtcaagagatattggttcaacaaatttgatggcctggaatatacttgtgattctttg |
34391766 |
T |
 |
| Q |
107 |
atgttttgtgatttttgaagatataatatcagtgaaggaaataaagc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34391765 |
atgttttgtgatttttgaagatataatattagtgaaggaaataaagc |
34391719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University