View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751-Insertion-27 (Length: 108)
Name: NF1751-Insertion-27
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751-Insertion-27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 5e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 5e-47
Query Start/End: Original strand, 6 - 108
Target Start/End: Original strand, 2848201 - 2848303
Alignment:
| Q |
6 |
caaaaagaacataataaccaacccaattttcaactccaaaattaaatggatgaacacaactcagtaacatggaagaacgagttcagcagatcacaacaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2848201 |
caaaaagaacataataaccaacccaattttcaagtccaaaattaaatggatgaacacaactcagcaacatggaagaacgagttcagcagatcacaacaaa |
2848300 |
T |
 |
| Q |
106 |
gtt |
108 |
Q |
| |
|
||| |
|
|
| T |
2848301 |
gtt |
2848303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University