View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1751-Insertion-29 (Length: 92)
Name: NF1751-Insertion-29
Description: NF1751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1751-Insertion-29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 4e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 4e-41
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 13257549 - 13257465
Alignment:
| Q |
8 |
catatgatagcgcaactcagtgagccaggtcctcaaagcttccttgtttgccaaggattaggagacatattacttttactcgcac |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13257549 |
catatgatagcgcaactcagtgagccaggtcctcaaagcttccttgtttgccaaggattaggagacatattacttttactcgcac |
13257465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University