View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17510_high_2 (Length: 591)
Name: NF17510_high_2
Description: NF17510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17510_high_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 485; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 485; E-Value: 0
Query Start/End: Original strand, 1 - 591
Target Start/End: Complemental strand, 6917695 - 6917094
Alignment:
| Q |
1 |
caccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagcattttatattgagtgtgctcaaacaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917695 |
caccatctcttagtggaaactgagtgtttgtgatcaatattattattgaataataagtctgtgcatttagcattttatattgagtgtgctcaaacaacaa |
6917596 |
T |
 |
| Q |
101 |
gcaaaaggaaaatcagaacctatatgtttcggaatcaacctcgccgcgctcaatcttgatggcctggaacttgcctttctggacagttgtgacctctgta |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6917595 |
gcaaatggaaaatcagaacctatatgtttcgaaatcaacctcgccgcgctcaatcttgatggcctggaacttgccattctggacagttgtgacctctgta |
6917496 |
T |
 |
| Q |
201 |
-ggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgtttcctgttgcagaactggtgtgtgttctcgttgggctcaactgttgccgg |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917495 |
tggggagcgaagtgctcccggcttcaaactcgtctccggatagtacctgttccctgttgcagaactggtgtgtgttctcgttgggctcaactgttgccgg |
6917396 |
T |
 |
| Q |
300 |
gaacgaacacggcttcagat-aattcttgggcgg--tctcctgggcggctaggcttccacgagcacagcacagctcaaactgattgccagatacgggagc |
396 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||| ||||| ||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6917395 |
gaacgaacacggcttcagatcaattcttgggcggcctctcctgggtggctacgcttccacgagcatggcacagctcaaactgtttgccagatacgggagc |
6917296 |
T |
 |
| Q |
397 |
ggactcgtctcaaactgctgcggcttcaggatcaatctctgagcgtgtccatgggaaactcggggtgctgtcaatgg-------cgagctttgactaatg |
489 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
6917295 |
agactcgtctcaaactgctgcggcttcaggatcaatctctgagcgtgtctgtgggaaactcggcgtgctgtcaatggcgctgctcgagctttgactaatg |
6917196 |
T |
 |
| Q |
490 |
aaggcggttcaacggagacttcactgtcgccgccgtgaatgatgctaaactgaattttcttccaacagttcttctgcctattgagattcagaggaacatt |
589 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917195 |
aaggcggtttggcggagacttcactgtcgccgccgtgaatgatgctaaactgaattttcttccaacagttcttctgcctattgagattcagaggaacatt |
6917096 |
T |
 |
| Q |
590 |
gc |
591 |
Q |
| |
|
|| |
|
|
| T |
6917095 |
gc |
6917094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University