View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17511_low_3 (Length: 339)
Name: NF17511_low_3
Description: NF17511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17511_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 18 - 324
Target Start/End: Complemental strand, 8871357 - 8871051
Alignment:
| Q |
18 |
atggcaccagctgcaatcgtaactaacggcaccaccaccgtcactcccaccgtcacaacacgcttcgcctccgtctacagcgaagtccaaaacagccgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871357 |
atggcaccagctgcaatcgtaactaacggcaccaccaccgtcactcccaccgtcacaacacgcttcgcctccgtctacagcgaagtccaaaacagccgtg |
8871258 |
T |
 |
| Q |
118 |
tcgatcacaaactccgtcttccctccgttctccaagcaccgtttgccattgtcgatggtcctaaatcctccgccgctggaaatccaggtaaatcttcgcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871257 |
tcgatcacaaactccgtcttccctccgttctccaagcaccgttcgccattgtcgatggtcctaaatcctccgccgctggaaatccaggtaaatcttcgcc |
8871158 |
T |
 |
| Q |
218 |
gttcatttcattcacttcgatctgtacttgatctgtttttctaacttgatgtttgcatgtagatgagatcgcgaagctttttccgtatttgtttggacaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871157 |
gttcatttcattcacttcgatctgtacttgatctggttttctaacttgatgtttgcatgtagatgagatcgcgaagctttttccgtatttgtttggacaa |
8871058 |
T |
 |
| Q |
318 |
ccttctg |
324 |
Q |
| |
|
||||||| |
|
|
| T |
8871057 |
ccttctg |
8871051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University