View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17511_low_6 (Length: 248)
Name: NF17511_low_6
Description: NF17511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17511_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 44690384 - 44690156
Alignment:
| Q |
1 |
accaaagtattgtagtgctaattttatccatccatttgttgatttagataaattatcatactataaaaaagcaagataaaataattgcagattgcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690384 |
accaaagtattgtagtgctaattttatccatccatttgttgatttagataaattatcatactataaaaaagcaagataaaataattgcagattgcttcaa |
44690285 |
T |
 |
| Q |
101 |
gatgagacaatataatgccaatgtgcaatcatgtaatgtaatgaaaaacactccatgcgcatttggagataataatgcatctaaacccacaaacgtgaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44690284 |
gatgagacaatataatgccaatgtgcaatcatgtaatgtaatgaaaaacactccacgcgcatttggagataataatgcatctaaacccacaaacgtgaac |
44690185 |
T |
 |
| Q |
201 |
acatgcaaacaaatagtaagcacagttgg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44690184 |
acatgcaaacaaatagtaagcacagttgg |
44690156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 44690460 - 44690431
Alignment:
| Q |
8 |
tattgtagtgctaattttatccatccattt |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44690460 |
tattgtagtgctaattttatccatccattt |
44690431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University