View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17511_low_8 (Length: 227)
Name: NF17511_low_8
Description: NF17511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17511_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 26577250 - 26577057
Alignment:
| Q |
19 |
acacattacatcgaacatcaattattcaaataatcaaaatctattacattgcattacattgatctaaaacatgtaccttggtctttgtgattacaatatg |
118 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26577250 |
acacatcacatggaacatcaattattcaaataatcaaaatctattacattgcattacattgatctaaaacatgtaccttggtctttgtgattacaatatg |
26577151 |
T |
|
| Q |
119 |
gataaaagcaccaccaaaatacattatggataatatacaataagatatcccattttttggaaataacattaaagacattagtgttggagtataa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26577150 |
gataaaagcaccaccaaaatacattatggataatataccataagatatcccattttttggaaataacattaaagacatgagtgttggagtataa |
26577057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University