View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17512_high_25 (Length: 235)
Name: NF17512_high_25
Description: NF17512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17512_high_25 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 11055477 - 11055702
Alignment:
| Q |
12 |
agaaacaccaaattgtttt-aaaaaatatatgatgtatgtttgatattagagtgaatattttagaatcactccgatcatgattttctaaaaactacattt |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11055477 |
agaaacaccaaattgtttttaaaaaatatacgatgtatgtttgatatcagagtggatatttcagaatcactccgatcatgattttctaaaaattacattt |
11055576 |
T |
 |
| Q |
111 |
cgtaaattctacaaaatcaggatgaatcactgcgattctgatatactcatcctaat-agtttatacttattttggttatttgcagatttcttggtacaat |
209 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11055577 |
cgtagattctgcaaaatcaggatgaatcattgtgattctgatatactcatcctaataagcttatacttattttggttatttgcagatttcttggtacaat |
11055676 |
T |
 |
| Q |
210 |
ttcaggaagcaaatccatgatttacc |
235 |
Q |
| |
|
||||||||||||||| | |||||||| |
|
|
| T |
11055677 |
ttcaggaagcaaatcgacgatttacc |
11055702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University