View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17512_low_8 (Length: 377)
Name: NF17512_low_8
Description: NF17512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17512_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 41 - 377
Target Start/End: Original strand, 35240905 - 35241241
Alignment:
| Q |
41 |
tttgtatggattgtttatgtcagataatttgattctacttcttggatttgcaattgattcattcaacaaaaacattttctatctatcatcttgattcgtg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35240905 |
tttgtatggattgtttatgtcagataatttgattatacttcttggatttgcaattgattcattcaacaaaaacattttctatctatcatcttgattcgtg |
35241004 |
T |
 |
| Q |
141 |
tgatattcccgtgacattacatggggatatccacagacaacgtaactggacttgttcttgcggtttcttcaagcattttcattggcactagttttattgt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35241005 |
tgatattcccgtgacattacatggggatatccacagacaacgtaactggacttgttcttgcggtttcttcaagcattttcattggcactagttttattgt |
35241104 |
T |
 |
| Q |
241 |
tnnnnnnnnnnnnnnnnnnnnntccagcactagaggaagaagcgcaggttcaccttcttgaattaatgtgcttactctttgataccctgaatttttattt |
340 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35241105 |
taaaaagatggggctaaaaaaatccagcaccagaggaagaagcgcaggttcaccttcttgaattaatgtgcttactctttgataccctaaatttttattt |
35241204 |
T |
 |
| Q |
341 |
gttgtgaattgttgaattctcaattgttttcttttaa |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35241205 |
gttgtgaattgttgaattctcaattgttttcttttaa |
35241241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University